JHOS-2Homo sapiens (Human)Cancer cell line
Also known as: JHOS2
Quick Overview
Human high-grade serous ovarian cancer cell line for research.
Detailed Summary
Research Applications
Key Characteristics
Basic Information
Database ID | CVCL_4647 |
---|---|
Species | Homo sapiens (Human) |
Tissue Source | Lymph node[UBERON:UBERON_0000029] |
Donor Information
Age | 45 |
---|---|
Age Category | Adult |
Sex | Female |
Race | asian |
Disease Information
Disease | High grade ovarian serous adenocarcinoma |
---|---|
Lineage | Ovary/Fallopian Tube |
Subtype | High-Grade Serous Ovarian Cancer |
OncoTree Code | HGSOC |
DepMap Information
Source Type | RIKEN |
---|---|
Source ID | ACH-000132_source |
Known Sequence Variations
Type | Gene/Protein | Description | Zygosity | Note | Source |
---|---|---|---|---|---|
MutationSimple | TP53 | c.767_782+4delTGACCTGGAGTCTTCCAGTG | Unspecified | - | Unknown, Unknown |
Haplotype Information (STR Profile)
Short Tandem Repeat (STR) profile for cell line authentication.
Loading gene expression data...
Publications
Pan-cancer proteomic map of 949 human cell lines.";
Robinson P.J., Zhong Q., Garnett M.J., Reddel R.R.
Cancer Cell 40:835-849.e8(2022).
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Sellers W.R.
Nature 569:503-508(2019).
Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens.
Stronach E.A., Saez-Rodriguez J., Yusa K., Garnett M.J.
Nature 568:511-516(2019).
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.
Cancer Res. 79:1263-1273(2019).
Integrated genomic, epigenomic, and expression analyses of ovarian cancer cell lines.
Velculescu V.E., Scharpf R.B.
Cell Rep. 25:2617-2633(2018).
Integrative proteomic profiling of ovarian cancer cell lines reveals precursor cell associated proteins and functional status.
Tyanova S., Montag A., Lastra R.R., Lengyel E., Mann M.
Nat. Commun. 7:12645.1-12645.14(2016).
A landscape of pharmacogenomic interactions in cancer.";
Wessels L.F.A., Saez-Rodriguez J., McDermott U., Garnett M.J.
Cell 166:740-754(2016).
Evaluating cell lines as tumour models by comparison of genomic profiles.
Domcke S., Sinha R., Levine D.A., Sander C., Schultz N.
Nat. Commun. 4:2126.1-2126.10(2013).
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.
Nature 483:603-607(2012).
Establishment and characterization of cell lines derived from serous adenocarcinoma (JHOS-2) and clear cell adenocarcinoma (JHOC-5, JHOC-6) of human ovary.
Endoh H., Kimura E., Yasuda M., Tanaka T., Ishikawa H.
Hum. Cell 12:131-138(1999).